HiBiT®, HaloTag®, NanoLuc®, and NanoBiT® tools now available for your cells.
Products

Products

Tell us your gene editing goals — we'll help you build the right solution Details Here

LDLR-KO gRNA1
All in one vector for LDLR-KO
G004a LDLR-KO gRNA1 10 μg at 0.5 μg/μL in TE $751.00
G004b LDLR-KO gRNA2 10 μg at 0.5 μg/μL in TE $751.00
G004c LDLR-KO gRNA3 10 μg at 0.5 μg/μL in TE $751
Description
Specifications
Documents

Gene editing technologies give scientists the ability to change an organism's genetic material. Recently, CRISPR-Cas9 becomes a popular tool, as it is a specific, efficient and versatile gene-editing technology. The system consists of two parts: the Cas9 enzyme and a guide RNA. Cas9 endonuclease acts as a molecular scissor and uses CRISPR sequences as a guide to recognize and cleave specific strands of DNA that are complementary to the CRISPR sequence. The guide RNA consists of a pre-designed RNA sequence (about 20 bases long) located within a longer RNA scaffold. The scaffold part binds to DNA and the guide RNA ‘guides’ Cas9 to the complementary region in the gene to be edited. This allows the Cas9 to cut at the right site in the genome. Hence, by manipulating the nucleotide sequence of the guide RNA, the CRISPR-Cas9 system could be programmed to target any DNA sequence for cleavage. CRISPR-Cas9 technique has a wide variety of applications such as in basic biomedical research, development of biotechnological products, and treatment of medical conditions that have a genetic component.

In our vector, we have U6 promoter driving a single  guide RNA expression while CBh promoter transcribe SpCas9 gene linked to Puromycin selection marker by T2A.

Vector Information

The sgRNA expressing vector contains SpCas9 gene driven by CBh promoter and the 20 nucleotides guide RNA sequences are transcribed by U6 promoter with an invariant gRNA scaffold immediately following the guide RNA sequences. The guide sequences of LDLR are: gRNA1: TCTGTCGCCCACTGAGAGAG, gRNA2: ACGAGTTCCAGTGCCAAGAC, gRNA3: GGGACTCATCAGAGCCATCC.

 

IMPORTANT NOTICE

Store the vial at -20°C immediately upon receipt.

Product Name LDLR-KO gRNA1
Gene Name

LDLR

Target

Intron 1

gRNA Sequence

TCTGTCGCCCACTGAGAGAG

gRNA No

1

Shipping Condition

Room Temperature - 2 Day Shipping

Storage and Stability

Store at -20°C immediately upon receipt. This product is stable for 6 months when stored as directed.

Quality Control

This plasmid is sequence verified.

Restricted Use

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Have Questions?

If you don't see the product you're looking for, please don't hesitate to CONTACT US. Our dedicated team of scientists will provide you our best solutions for your desired results.

Contact Our Experts