LLGL1-KO gRNA5
Catalog# | Unit | Unit Price (USD) | Actions |
---|---|---|---|
G005b | 10 μg at 0.5 μg/μL in TE | $729.00 | Add to Cart |
Description:
Gene editing technologies give scientists the ability to change an organism's genetic material. Recently, CRISPR-Cas9 becomes a popular tool, as it is a specific, efficient and versatile gene-editing technology. The system consists of two parts: the Cas9 enzyme and a guide RNA. Cas9 endonuclease acts as a molecular scissor and uses CRISPR sequences as a guide to recognize and cleave specific strands of DNA that are complementary to the CRISPR sequence. The guide RNA consists of a pre-designed RNA sequence (about 20 bases long) located within a longer RNA scaffold. The scaffold part binds to DNA and the guide RNA ‘guides’ Cas9 to the complementary region in the gene to be edited. This allows the Cas9 to cut at the right site in the genome. Hence, by manipulating the nucleotide sequence of the guide RNA, the CRISPR-Cas9 system could be programmed to target any DNA sequence for cleavage. CRISPR-Cas9 technique has a wide variety of applications such as in basic biomedical research, development of biotechnological products, and treatment of medical conditions that have a genetic component.
In our vector, we have U6 promoter driving a single guide RNA expression while CBh promoter transcribe SpCas9 gene linked to Puromycin selection marker by T2A.
Vector Information
The sgRNA expressing vector contains SpCas9 gene driven by CBh promoter and the 20 nucleotides guide RNA sequences are transcribed by U6 promoter with an invariant gRNA scaffold immediately following the guide RNA sequences. The guide sequences of Neo1 are: gRNA2: TGCCAGACGACTACCGCTGT, gRNA5: GGACCACTGTGACTCGGGTA, gRNA6: AAGCGTCTGCCCCTCGAGCA, gRNA14: GGGAACCAGGTATGTAGGTG.
IMPORTANT NOTICE
Store the vial at -20°C immediately upon receipt.


Note: Bacterial culture of pLenti vectors should be done in medium containing 50 μg/mL Ampicillin. For maximal plasmid yield and quality, we recommend Stbl3 competent cells (Invitrogen).
Specifications:
Product Name | LLGL1-KO gRNA5 |
---|---|
Gene Name | LLGL1 |
Target | Exon 5 |
gRNA Sequence | GGACCACTGTGACTCGGGTA |
gRNA No | 5 |
Shipping Condition |
Room Temperature - 2 Day Shipping |
Storage and Stability |
Store at -20°C immediately upon receipt. This product is stable for 6 months when stored as directed. |
Quality Control | This plasmid is sequence verified. |
Restricted Use |
For Research Use Only. Not for use in diagnostic or therapeutic procedures. |