Banner

Products

RABGGTB-KO gRNA2

Catalog# Unit Unit Price (USD) Actions
G009b 10 μg at 0.5 μg/μL in TE $695.00 Add to Cart
Description:

Gene editing technologies give scientists the ability to change an organism's genetic material. Recently, CRISPR-Cas9 becomes a popular tool, as it is a specific, efficient and versatile gene-editing technology. The system consists of two parts: the Cas9 enzyme and a guide RNA. Cas9 endonuclease acts as a molecular scissor and uses CRISPR sequences as a guide to recognize and cleave specific strands of DNA that are complementary to the CRISPR sequence. The guide RNA consists of a pre-designed RNA sequence (about 20 bases long) located within a longer RNA scaffold. The scaffold part binds to DNA and the guide RNA ‘guides’ Cas9 to the complementary region in the gene to be edited. This allows the Cas9 to cut at the right site in the genome. Hence, by manipulating the nucleotide sequence of the guide RNA, the CRISPR-Cas9 system could be programmed to target any DNA sequence for cleavage. CRISPR-Cas9 technique has a wide variety of applications such as in basic biomedical research, development of biotechnological products, and treatment of medical conditions that have a genetic component.

Vector Information

The sgRNA expressing vector contains SpCas9 gene driven by CBh promoter and the 20 nucleotides guide RNA sequences are transcribed by U6 promoter with an invariant gRNA scaffold immediately following the guide RNA sequences. The guide sequences of RABGGTB are: gRNA1: TGATCAGTGCTGTTAAGGTC, gRNA2: CTATTGGGGTCTGACAGTAA, gRNA3: GGTGGAATAAGTGCTAGTAT, gRNA4: ACAAGTGAAGCTGTCCTACA.

 

IMPORTANT NOTICE

Store the vial at -20°C immediately upon receipt.

images/Desc_Images/G009b_1.png
Figure 1. Partial vector map showing the promoters for gRNA and SpCas9 gene.
images/Desc_Images/G009b_2.png
Figure 2. Sites where the gRNAs complementary sequences will bind to Exon 3 of RABGGTB gene.
Note: Bacterial culture of pLenti vectors should be done in medium containing 50 μg/mL Ampicillin. For maximal plasmid yield and quality, we recommend Stbl3 competent cells (Invitrogen).
Specifications:
Product Name RABGGTB-KO gRNA2
Gene Name

RABGGTB

Target

Exon 3

gRNA Sequence

CTATTGGGGTCTGACAGTAA

gRNA No

2

Shipping Condition

Room Temperature - 2 Day Shipping

Storage and Stability

Store at -20°C immediately upon receipt. This product is stable for 6 months when stored as directed.

Quality Control

This plasmid is sequence verified.

Restricted Use

For Research Use Only. Not for use in diagnostic or therapeutic procedures.